Sequence ID | >WENV170784320 |
Genome ID | MCHG01000828 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 4392 |
End posion on genome | 4482 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
aaggattagt |
tRNA gene sequence |
GGAGAAGTACTCAAGTGGCTGAAGAGGACGGTTTGCTAAACCGTTAGGGTGGGTAACTGC |
Downstream region at tRNA end position |
aaaaatgtta |
Secondary structure (Cloverleaf model) | >WENV170784320 Ser GCT t GCCA aaaaatgtta G - C G - C A - T G - C A - T A - T G - C T C T C T C C C A T G A A | | | | | G G A C T C G A G G G C G | | | T T C A G A G T G A G TAGGGTGGGTAACTGCCGC A - T C - G G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |