Sequence ID | >WENV170784324 |
Genome ID | MCHG01000828 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 4836 |
End posion on genome | 4919 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ctactcaaat |
tRNA gene sequence |
GGGCAGGTGGCCGAGTGGTTAAAGGCGACAGACTGTAAATCTGTTCCGCGAGGTACGATG |
Downstream region at tRNA end position |
tcttagatag |
Secondary structure (Cloverleaf model) | >WENV170784324 Tyr GTA t ACCA tcttagatag G - C G - C G - C C - G A - T G - C G - C T A T C T A C C A T G A G | | | | | G G G C C G G A T G G C G | | | T T T A G G C T A A G TCCGCGAGGTAC A - T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |