Sequence ID | >WENV170784332 |
Genome ID | MCHG01000835 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 336 |
End posion on genome | 260 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gttcttgtag |
tRNA gene sequence |
CGCGGGGTGGAGCAGTTCGGTAGCTCGCTGGGCTCATAACCCAGAGGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
agacaacccc |
Secondary structure (Cloverleaf model) | >WENV170784332 Met CAT g ACAA agacaacccc C A G - C C - G G - C G - C G - C G - C T A T C G T C C A T G A G | + | | | A T C G A G G T A G G C C | | | | T T G G C T C G T A G AGGTC C - G T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |