Sequence ID | >WENV170784334 |
Genome ID | MCHG01000862 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 4898 |
End posion on genome | 4985 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cggccggcca |
tRNA gene sequence |
GGAGAATTCGCCTAGTGGCCTATGGCGCACGCTTGGAAAGCGTGTTGGGTGAAAGCCCTC |
Downstream region at tRNA end position |
cgtagccccc |
Secondary structure (Cloverleaf model) | >WENV170784334 Ser GGA a GCCA cgtagccccc G - C G - C A - T G - C A - T A - T T - A T A T C C C C C A T G A C | | | | | G G T C C G G G G G G C G | | | T T C T G G C C T A G TTGGGTGAAAGCCCTC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |