Sequence ID | >WENV170784338 |
Genome ID | MCHG01000948 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 1244 |
End posion on genome | 1320 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
agtacccttT |
tRNA gene sequence |
GGGATAGTAGGGTAGCTTGGTCCATCCTCGAGCGTTTGGGACGCTTGGACCGCGGTTCAA |
Downstream region at tRNA end position |
actatttttt |
Secondary structure (Cloverleaf model) | >WENV170784338 Pro TGG T ATta actatttttt G - C G - C G - C A - T T - A A - T G - C T A T G C G C C A T C G A A | | | | | A T T G G G C G C G G C G | | + T T G T C C T T C C A C GGAC G + T A - T G - C C - G G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |