Sequence ID | >WENV170784339 |
Genome ID | MCHG01000959 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 2187 |
End posion on genome | 2114 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
acatctgtaT |
tRNA gene sequence |
GCGACTGTGGTTTAGTGGCTATGACCTGAGCTTCCCAAGCTTAGAACCCGGGTTCGAATC |
Downstream region at tRNA end position |
aaaacttttt |
Secondary structure (Cloverleaf model) | >WENV170784339 Gly CCC T ATtg aaaacttttt G - C C - G G - C A - T C - G T - A G - C T A T G G C C C A T G A G | | | | | G G T T T G C C G G G C G + | | T T C T G A C T A C GAAC T - A G + T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |