Sequence ID | >WENV170784340 |
Genome ID | MCHG01000962 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 4381 |
End posion on genome | 4309 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gtcggtgcat |
tRNA gene sequence |
TCCGCCGTGGTGTAATGGCAGCACGACAGCCTTTGGAGCTGTTAGGTCCAGGTTCGAGTC |
Downstream region at tRNA end position |
ttcgatccac |
Secondary structure (Cloverleaf model) | >WENV170784340 Gln TTG t GCgg ttcgatccac T - A C - G C - G G - C C - G C - G G - C T G T G G T C C A A A G | | | | | G T T G T G C C A G G C G + | | | T T G G C A C C A G TAGGT A - T C - G A - T G - C C - G C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |