Sequence ID | >WENV170784343 |
Genome ID | MCHG01000966 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 769 |
End posion on genome | 843 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aactaaatac |
tRNA gene sequence |
GCTGGCATGGCTCAACGGTAGAGCAGCTGACTTGTAATCAGCAGGTTGTAGGTTCGATTC |
Downstream region at tRNA end position |
tatgaaatat |
Secondary structure (Cloverleaf model) | >WENV170784343 Thr TGT c TCCA tatgaaatat G - C C - G T - A G - C G - C C - G A - T T T T T A T C C A A A G + | | | | G C C T C G G T A G G C G | | | | T T G G A G C T A A AGGTT G - C C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |