Sequence ID | >WENV170784354 |
Genome ID | MCHG01001021 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 110 |
End posion on genome | 35 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
gtagcagtcg |
tRNA gene sequence |
GGGGCTATGGCGCAGCTGGTAGCGCGCCTCGTTCGCATCGAGGAGGTCAGGAGTTCGAAT |
Downstream region at tRNA end position |
ctgtttcagg |
Secondary structure (Cloverleaf model) | >WENV170784354 Ala CGC g ACCG ctgtttcagg G - C G - C G + T G - C C - G T - A A - T T A T T C C T C A C G A G | | | | | G T C G C G A G G A G C G | | | | T T G G C G C T A G AGGTC C - G C - G T - A C - G G - C T T T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |