Sequence ID | >WENV170784360 |
Genome ID | MCHG01001248 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 316 |
End posion on genome | 230 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tgtcctttgT |
tRNA gene sequence |
GACGAGATAGCCAAGCCCGGTATGGCGCGGGATTGCTAATCCCGTGATGCCCCGCATCCC |
Downstream region at tRNA end position |
ttcttttttg |
Secondary structure (Cloverleaf model) | >WENV170784360 Ser GCT T GTtt ttcttttttg G - C A - T C - G G - C A - T G - C A - T T G T C C C C C A C G A A | | | | | G C A C C G G G G G G C C | | | | T T G T G G C G T A G TGATGCCCCGCATCCC C - G G - C G - C G - C A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |