Sequence ID | >WENV170784361 |
Genome ID | MCHG01001279 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 1326 |
End posion on genome | 1414 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
gctctatcgT |
tRNA gene sequence |
GCGAGAGTTGCCCAGCCAGGTCAAAGGCGCTGGATTCAGAGTCCAGTCTTGTAGGAGTTC |
Downstream region at tRNA end position |
aactttttta |
Secondary structure (Cloverleaf model) | >WENV170784361 Leu CAG T ATCA aactttttta G - C C - G G - C A - T G - C A - T G - C T A T C A C G C A C C G A T | | | | | G A C C C G G T G C G C G | | | T T G A G G C T C A A G TCTTGTAGGAGTTC C - G T - A G - C G - C A - T T G T A C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |