Sequence ID | >WENV170784366 |
Genome ID | MCHG01001412 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 1276 |
End posion on genome | 1352 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ctcatagcga |
tRNA gene sequence |
GGCCCTGTAGCGCAGTTGGTTAGCGCGCCGCCCTGTCACGGCGGAGGTCGCCGGTTCAAG |
Downstream region at tRNA end position |
agcaacaagc |
Secondary structure (Cloverleaf model) | >WENV170784366 Asp GTC a GCAA agcaacaagc G - C G + T C - G C - G C - G T - A G - C T G T T G G C C A T G A A + | | | | A T C G C G G C C G G C G | | | | T T G G C G C T T A G AGGTC C - G C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |