Sequence ID | >WENV170784380 |
Genome ID | MCHG01002275 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 477 |
End posion on genome | 550 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gtaccaattt |
tRNA gene sequence |
GCCTCGTTGGCTCAGCCCGGTAGAGCGAGTGACTTGTAATCACTAGGTCGCGTGTTCGAA |
Downstream region at tRNA end position |
cgttttttct |
Secondary structure (Cloverleaf model) | >WENV170784380 Thr TGT t Ttat cgttttttct G - C C - G C - G T - A C - G G - C T - A T A T C G C A C A C G A G | | | | | G C C T C G G C G T G C C | | | | T T G G A G C G T A G AGGTC A - T G - C T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |