| Sequence ID | >WENV170786310 |
| Genome ID | MDSV01001188 |
| Phylum/Class | [MDSV] marine metagenome; seawater |
| Species | |
| Start position on genome | 3297 |
| End posion on genome | 3221 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
acgccatttt |
| tRNA gene sequence |
CGGGGTGTAGCGCAGTCTGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCGGGGGTTCGAA |
| Downstream region at tRNA end position |
ctttttcggc |
| Secondary structure (Cloverleaf model) | >WENV170786310 Pro TGG
t ACCA ctttttcggc
C - G
G - C
G - C
G - C
G - C
T T
G - C T A
T C T C C C A
T G A A | + | | | G
C C G C G G G G G G C
T | | | | T T
G G C G C
G T A G ATGTC
C - G
C - G
T - A
G - C
C - G
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |