| Sequence ID | >WENV170788079 |
| Genome ID | MDSV01027305 |
| Phylum/Class | [MDSV] marine metagenome; seawater |
| Species | |
| Start position on genome | 643 |
| End posion on genome | 718 |
| Amino Acid | Ala |
| Anticodon | GGC |
| Upstream region at tRNA start position |
ggactttttt |
| tRNA gene sequence |
GGGGCCATAGCTCAGCTGGTAGAGCACCTGCATGGCATGCAGGGGGTCAGCGGTTCGAAT |
| Downstream region at tRNA end position |
taaattatgc |
| Secondary structure (Cloverleaf model) | >WENV170788079 Ala GGC
t ACTA taaattatgc
G - C
G - C
G + T
G - C
C - G
C - G
A - T T A
T T C G C C A
C G A A | | | | | G
T C T C G A G C G G C
G | | | | T T
G G A G C
T A A GGGTC
C - G
C - G
T - A
G - C
C - G
A T
T A
G G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |