| Sequence ID | >WENV170788220 |
| Genome ID | MDSV01030026 |
| Phylum/Class | [MDSV] marine metagenome; seawater |
| Species | |
| Start position on genome | 48 |
| End posion on genome | 124 |
| Amino Acid | Arg |
| Anticodon | TCT |
| Upstream region at tRNA start position |
gtccggattc |
| tRNA gene sequence |
GGCCCCGTAGCTCAGCTGGATAGAGCATCCGCCTTCTAAGCGGACGGTCGCAGGTTCGAA |
| Downstream region at tRNA end position |
gttccctaaa |
| Secondary structure (Cloverleaf model) | >WENV170788220 Arg TCT
c GCCA gttccctaaa
G - C
G + T
C - G
C - G
C - G
C - G
G - C T A
T C G T C C A
C G A A | | | | | G
T C T C G G C A G G C
G | | | | T T
G G A G C
A T A A CGGTC
T - A
C - G
C - G
G - C
C - G
C A
T A
T C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |