| Sequence ID | >WENV170789228 |
| Genome ID | MDSV01046860 |
| Phylum/Class | [MDSV] marine metagenome; seawater |
| Species | |
| Start position on genome | 1340 |
| End posion on genome | 1264 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
atataaccat |
| tRNA gene sequence |
GTCTCGGTAGCTCAGCTGGTTAGAGCGGCGGATTCATAGCCCGCAGGTCGCGTGTTCAAG |
| Downstream region at tRNA end position |
tcttagaaag |
| Secondary structure (Cloverleaf model) | >WENV170789228 Met CAT
t ACTA tcttagaaag
G - C
T - A
C - G
T - A
C - G
G - C
G + T T G
T C G C A C A
C G A A | | | | | A
T C T C G G C G T G C
G | | | | T T
G G A G C
T T A G AGGTC
G - C
C - G
G - C
G - C
A C
T G
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |