| Sequence ID | >WENV170792154 |
| Genome ID | MDSV01095139 |
| Phylum/Class | [MDSV] marine metagenome; seawater |
| Species | |
| Start position on genome | 1 |
| End posion on genome | 74 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
nnnnnnnnnn |
| tRNA gene sequence |
GCGCCTGTAGCTCAGTGGATTAGAGCACCTGACTACGGATCAGGGTGTCGGGAGTTCGAA |
| Downstream region at tRNA end position |
aaaaattatg |
| Secondary structure (Cloverleaf model) | >WENV170792154 Arg ACG
n Gttt aaaaattatg
G - C
C - G
G - C
C - G
C - G
T - A
G - C T A
T C T C T C A
T G A A | + | | | G
G C T C G G G G A G C
G | | | | T T
A G A G C
T T A A GTGTC
C - G
C - G
T - A
G - C
A - T
C A
T G
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |