| Sequence ID | >WENV170793406 |
| Genome ID | MDSV01115668 |
| Phylum/Class | [MDSV] marine metagenome; seawater |
| Species | |
| Start position on genome | 35304 |
| End posion on genome | 35378 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
atttgaatgt |
| tRNA gene sequence |
GGCCCCTTCGTCTAGCGGTTAGGACACCACCCTTTCACGGTGTAAACACGGGTTCGAGTC |
| Downstream region at tRNA end position |
tcttctgcaa |
| Secondary structure (Cloverleaf model) | >WENV170793406 Glu TTC
t ACCA tcttctgcaa
G - C
G + T
C - G
C - G
C - G
C - G
T - A T G
T T G C C C A
C G A C | | | | | G
G T C T G A C G G G C
G + | | | T T
T G G A C
T A A AAAC
C T
C - G
A - T
C - G
C - G
C C
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |