The detailed information of tRNA gene sequence


Sequence ID>WENV170846188
Genome IDMDTA01037843
Search identical group
Phylum/Class[MDTA] marine metagenome; seawater
Species
Start position on genome 8
End posion on genome 83
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
nngatcttaT
tRNA gene sequence
GTCTCGGTAGCTCAGCTGGTCAGAGCGGCGGATTCATAGCCCGCAGGTCGCGTGTTCAAG
TCACGCTCGAGACATaa
Downstream region at tRNA end position
aaatacttca
Secondary structure (Cloverleaf model)
>WENV170846188	Met	CAT
                   T      ATaa aaatacttca
                     G - C
                     T - A
                     C - G
                     T - A
                     C - G
                     G - C
                     G + T          T G
                    T     C G C A C     A
      C G A        A      | | | | |     A
    T       C T C G       G C G T G     C
    G       | | | |                 T T
    G       G A G C
      T C A        G     AGGTC
                    G - C
                    C - G
                    G - C
                    G - C
                    A   C
                  T       G
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK