| Sequence ID | >WENV170850176 |
| Genome ID | MDTA01109860 |
| Phylum/Class | [MDTA] marine metagenome; seawater |
| Species | |
| Start position on genome | 3 |
| End posion on genome | 74 |
| Amino Acid | Gln |
| Anticodon | TTG |
| Upstream region at tRNA start position |
nnnnnnnnaa |
| tRNA gene sequence |
TGGGCCGTCGCCAAGTGGTAAGGCAGCGGGTTTTGGTCCCGCCATTCCTAGGTTCGAATC |
| Downstream region at tRNA end position |
ttctcgaatc |
| Secondary structure (Cloverleaf model) | >WENV170850176 Gln TTG
a Gttt ttctcgaatc
T - A
G - C
G - C
G - C
C - G
C - G
G - C T A
T G A T C C A
G A C | | | | | G
T A C C G C T A G G C
G | | | T T
G A G G C
T A A CATTC
G - C
C - G
G - C
G - C
G - C
T T
T G
T T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |