Sequence ID | >WENV170957263 |
Genome ID | MKFH01000090 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 193 |
End posion on genome | 282 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
taaagtgcaa |
tRNA gene sequence |
GGAGAGATGGCCGAGTGGCTTAAGGCGCACGCTTGGAAAGCGTGTATACGGGCAACCGTA |
Downstream region at tRNA end position |
actgctctgt |
Secondary structure (Cloverleaf model) | >WENV170957263 Ser GGA a GCCA actgctctgt G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T C A G G C T T A G TATACGGGCAACCGTATC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |