Sequence ID | >WENV170957266 |
Genome ID | MKFH01000132 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 366 |
End posion on genome | 441 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
catcgccaat |
tRNA gene sequence |
GCCGGTTTAGCTCAGTTGGTAGAGCGCCTGCCTTGTAAGCAGGATGTCAGCGGTTCGAGT |
Downstream region at tRNA end position |
gcacaacagg |
Secondary structure (Cloverleaf model) | >WENV170957266 Thr TGT t ACCA gcacaacagg G - C C - G C - G G - C G + T T - A T - A T G T T T G C C A T G A A | + | | | G T C T C G A G C G G C G | | | | T T G G A G C T A G ATGTC C - G C - G T - A G - C C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |