Sequence ID | >WENV170957267 |
Genome ID | MKFH01000212 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 281 |
End posion on genome | 205 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
atgcgttccc |
tRNA gene sequence |
GCGCCGGTAGCTCAGCTGGATAGAGCACCAGACTTCGAATCTGGGGGTCAGGGGTTCGAA |
Downstream region at tRNA end position |
ttgaccggcc |
Secondary structure (Cloverleaf model) | >WENV170957267 Arg TCG c GCCA ttgaccggcc G - C C - G G - C C - G C - G G - C G - C T A T T T C C C A C G A A | + | | | G T C T C G A G G G G C G | | | | T T G G A G C A T A A GGGTC C - G C - G A - T G - C A - T C A T A T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |