Sequence ID | >WENV170957268 |
Genome ID | MKFH01000228 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 375 |
End posion on genome | 287 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
acgcgtacaa |
tRNA gene sequence |
GGAGAGATGACTGAGTGGCCGAAAGTACCTCACTGCTAACGAGGCGTAGGAGTCAAATCC |
Downstream region at tRNA end position |
cacctcattt |
Secondary structure (Cloverleaf model) | >WENV170957268 Ser GCT a Gtac cacctcattt G - C G - C A - T G - C A - T G - C A - T T A T C G C C C A T G A G | | | | | G G G T C A G C G G G C G | | | T T C A A G T C G A A CGTAGGAGTCAAATCCTACC C - G C - G T - A C - G A C C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |