Sequence ID | >WENV170957274 |
Genome ID | MKFH01000360 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 538 |
End posion on genome | 612 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
agagaatcac |
tRNA gene sequence |
GTCCCCGTAGCTCAACGGATAGAGCAGCAGCCTTCGAAGCTGTTGATGGGGGTTCGATTC |
Downstream region at tRNA end position |
gggtagtgcg |
Secondary structure (Cloverleaf model) | >WENV170957274 Arg TCG c ACCC gggtagtgcg G - C T - A C - G C - G C - G C - G G - C T T T C T C C C A C A A A | + | | | G G C T C G G G G G G C G | | | | T T A G A G C T A A TGAT G + T C - G A - T G - C C - G C A T A T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |