Sequence ID | >WENV170957275 |
Genome ID | MKFH01000620 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 281 |
End posion on genome | 358 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tcggccgcaT |
tRNA gene sequence |
TCCGGGGTAGCTCAGCTGGTAGAGCAGTGGACTGTTAATCCATTGGTCGTGGGTTCGAAT |
Downstream region at tRNA end position |
Atgtgggatt |
Secondary structure (Cloverleaf model) | >WENV170957275 Asn GTT T AGCC Atgtgggatt T + G C - G C C G - C G - C G - C G - C T A T C A C C C A C G A A | | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A TGGTC G + T T - A G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |