Sequence ID | >WENV170957276 |
Genome ID | MKFH01000681 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 303 |
End posion on genome | 228 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
gtgggttttt |
tRNA gene sequence |
GCCACCTTAGCTCAGTCGGTAGAGCGGCGCTTTCGTAAAGCGTAGGTCGCCGGTTCGATC |
Downstream region at tRNA end position |
gaatctggta |
Secondary structure (Cloverleaf model) | >WENV170957276 Thr CGT t TCCA gaatctggta G - C C - G C - G A - T C - G C - G T - A C T T C G G C C A T G A A | | | | | G C C T C G G C C G G C G | | | | T T G G A G C T A G AGGTC G + T C - G G - C C - G T - A T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |