Sequence ID | >WENV170957277 |
Genome ID | MKFH01000687 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 843 |
End posion on genome | 918 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ccgtctgtct |
tRNA gene sequence |
GCCTCCGTAGCTCAGTGGATAGAGCGAGGATTTGCTACGTCCAGGGTCGTCGGTTCGAAT |
Downstream region at tRNA end position |
actcccgtaa |
Secondary structure (Cloverleaf model) | >WENV170957277 Ser GCT t GCCT actcccgtaa G - C C - G C - G T - A C - G C - G G - C T A T C A G C C A T G A A | | | | | G G C T C G G T C G G C G | | | | T T A G A G C T A G GGGTC A A G - C G - C A - T T + G T C T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |