Sequence ID | >WENV170957278 |
Genome ID | MKFH01000711 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 118 |
End posion on genome | 192 |
Amino Acid | Ile |
Anticodon | TAT |
Upstream region at tRNA start position |
gcgtagacat |
tRNA gene sequence |
GGGCCCGTAGCTCAACTGGTAGAGCAGGATGCTTATACCATCAAGGTTTCCTGGTTCGAA |
Downstream region at tRNA end position |
ttcgccactc |
Secondary structure (Cloverleaf model) | >WENV170957278 Ile TAT t ACac ttcgccactc G - C G - C G - C C - G C - G C - G G - C T A T G G A C C A C A A A | | | | | G T C T C G C C T G G C G | | | | T T G G A G C T A A AGGTTT G A G - C A - T T - A G - C C C T A T A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |