Sequence ID | >WENV170957279 |
Genome ID | MKFH01000711 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 503 |
End posion on genome | 577 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ttattaattc |
tRNA gene sequence |
GGGCGGTTAGCTCAGTTGGTAGAGCGCCTCGTTTACACCGAGGATGTCGGGGGGTTCGAG |
Downstream region at tRNA end position |
gcatgaacct |
Secondary structure (Cloverleaf model) | >WENV170957279 Val TAC c ACac gcatgaacct G - C G - C G - C C - G G - C G - C T - A T G T C T C C C A T G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A G ATGTCG C - G C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |