Sequence ID | >WENV170957282 |
Genome ID | MKFH01000778 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 300 |
End posion on genome | 375 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
tgcgacattt |
tRNA gene sequence |
GGGGCCATAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGTCGGCGGTTCGATC |
Downstream region at tRNA end position |
atttcctccg |
Secondary structure (Cloverleaf model) | >WENV170957282 Ala GGC t ACCA atttcctccg G - C G - C G + T G - C C - G C - G A - T C T T C C G C C A C G A A | | | | | G T C T C G G G C G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |