Sequence ID | >WENV170957283 |
Genome ID | MKFH01001009 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 287 |
End posion on genome | 363 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
atttggacga |
tRNA gene sequence |
AGGGGTGTAGCTCAGTTGGCTAGAGCGTCGGTCTCCAAAACCGAAGGTCGCGGGTTCAAT |
Downstream region at tRNA end position |
aatacctcac |
Secondary structure (Cloverleaf model) | >WENV170957283 Trp CCA a GCCA aatacctcac A - T G - C G - C G - C G - C T - A G - C T T T C G T C C A T G A A | | + | | A T C T C G G C G G G C G | | | | T T G G A G C C T A G AGGTC T - A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |