Sequence ID | >WENV170957285 |
Genome ID | MKFH01001046 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 619 |
End posion on genome | 544 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
acattttcac |
tRNA gene sequence |
GCCGTTGTAGCTCAGTTGGTAGAGCATCTCCATGGTAAGGAGAAGGTCACCGGTTCAAGT |
Downstream region at tRNA end position |
tgggtgggta |
Secondary structure (Cloverleaf model) | >WENV170957285 Thr GGT c TCCA tgggtgggta G - C C - G C - G G - C T - A T - A G - C T G T T G G C C A T G A A | | | | | A T C T C G A C C G G C G | | | | T T G G A G C T A A AGGTC T - A C - G T - A C - G C - G A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |