Sequence ID | >WENV170957287 |
Genome ID | MKFH01001141 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 572 |
End posion on genome | 496 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ctatgcttat |
tRNA gene sequence |
CGCGGGGTAGAGCAGTCCGGTAGCTCGTCAGGCTCATAACCTGGAGGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
aaattatctt |
Secondary structure (Cloverleaf model) | >WENV170957287 Met CAT t ACCA aaattatctt C T G - C C - G G - C G - C G - C G - C T A T C A T C C A T G A A | | | | | A C C G A G G T A G G C C | | | | T T G G C T C G T A G AGGTC T + G C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |