Sequence ID | >WENV170957288 |
Genome ID | MKFH01001143 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 2004 |
End posion on genome | 1928 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tgcgtaacaa |
tRNA gene sequence |
GGGCTCGTAGCTCAGCTGGTTAGAGCGCGTCACTGATAATGACGAGGTCGGAGGTTCAAG |
Downstream region at tRNA end position |
tttacatggg |
Secondary structure (Cloverleaf model) | >WENV170957288 Ile GAT a ACCA tttacatggg G - C G - C G - C C - G T - A C - G G - C T G T C C T C C A C G A A | | | | | A T C T C G G G A G G C G | | | | T T G G A G C T T A G AGGTC C - G G - C T - A C - G A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |