Sequence ID | >WENV170957289 |
Genome ID | MKFH01001143 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 1866 |
End posion on genome | 1790 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
aaaatatcac |
tRNA gene sequence |
GGGGCATTAGCTCAGTTGGCTAGAGCACCTGCTTTGCAAGCAGGGGGTCCGGGGTTCGAG |
Downstream region at tRNA end position |
taagcagaat |
Secondary structure (Cloverleaf model) | >WENV170957289 Ala TGC c ACCA taagcagaat G - C G - C G + T G - C C - G A - T T - A T G T G C C C C A T G A A | | | | | G T C T C G C G G G G C G | | | | T T G G A G C C T A A GGGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |