Sequence ID | >WENV170957292 |
Genome ID | MKFH01001413 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 381 |
End posion on genome | 305 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gtgcaggcaa |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCACCAGACTACGAATCTGGGGGTCAGAGGTTCGAA |
Downstream region at tRNA end position |
attatctcca |
Secondary structure (Cloverleaf model) | >WENV170957292 Arg ACG a GCCA attatctcca G - C C - G G - C C - G C - G C - G G - C T A T T T T C C A C G A A | + | | | G T C T C G A G A G G C G | | | | T T G G A G C A T A A GGGTC C - G C - G A - T G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |