Sequence ID | >WENV170957293 |
Genome ID | MKFH01001417 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 286 |
End posion on genome | 197 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gtttggacga |
tRNA gene sequence |
GGAGAGGTGTCCGAGTGGTTGAAGGAGCACGCTTGGAAAGCGTGTATGCGGGCAACCGTA |
Downstream region at tRNA end position |
ttgtttgtga |
Secondary structure (Cloverleaf model) | >WENV170957293 Ser GGA a GCCA ttgtttgtga G - C G - C A - T G - C A - T G - C G + T T A T C G C C C A T G A G | | | | | G G G C C T G C G G G C G | | | T T T A G G A T G A G TATGCGGGCAACCGTATC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |