Sequence ID | >WENV170957295 |
Genome ID | MKFH01001548 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 245 |
End posion on genome | 321 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
gcaagtttac |
tRNA gene sequence |
GGGCGTATAGCTCAGCTGGTTAGAGCACAGTCCTGATAAGACTGAGGTCCCAGGTTCGAA |
Downstream region at tRNA end position |
tgttagataa |
Secondary structure (Cloverleaf model) | >WENV170957295 Ile GAT c ACCA tgttagataa G - C G - C G - C C - G G - C T + G A - T T A T G G T T C A C G A A | | | + | G T C T C G C C A G G C G | | | | T T G G A G C T T A A AGGTC C - G A - T G - C T - A C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |