Sequence ID | >WENV170957296 |
Genome ID | MKFH01001555 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 313 |
End posion on genome | 238 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aaaaatttcc |
tRNA gene sequence |
GCCGACGTAGCTCAATTGGCAGAGCAGCTGTTTTGTAAACAGCAGGTTGCGGGTTCGAGT |
Downstream region at tRNA end position |
tttaggaatt |
Secondary structure (Cloverleaf model) | >WENV170957296 Thr TGT c TCCA tttaggaatt G - C C - G C - G G - C A - T C - G G - C T G T C A C C C A T A A A | | | | G T C T C G G C G G G C G | | | | T T G G A G C C A A AGGTT G - C C - G T - A G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |