Sequence ID | >WENV170957297 |
Genome ID | MKFH01001657 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 422 |
End posion on genome | 495 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
caccagtttc |
tRNA gene sequence |
GCGGCGGTAGCTCAACGGTAGAGCCACTGGCTTCCAACCAGACGACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
acttcagcgc |
Secondary structure (Cloverleaf model) | >WENV170957297 Gly TCC c TCCA acttcagcgc G - C C - G G - C G - C C - G G - C G + T T T T C G G C C A A A A | | | | | G C C T C G G C C G G C G | | | | T T G G A G C T A C CGAC A A C - G T - A G - C G - C C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |