Sequence ID | >WENV170957299 |
Genome ID | MKFH01001789 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 317 |
End posion on genome | 241 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ttttcgacgt |
tRNA gene sequence |
GGGCCCATAGCTCAGTTGGTTAGAGCACCTGCCTTTTAAGCAGGGTGTCCTGGGTTCGAG |
Downstream region at tRNA end position |
ttttattgtt |
Secondary structure (Cloverleaf model) | >WENV170957299 Lys TTT t TCCA ttttattgtt G - C G - C G - C C - G C - G C - G A - T T G T G A C C C A T G A A | | | | | G T C T C G C T G G G C G | | | | T T G G A G C T T A A GTGTC C - G C - G T - A G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |