Sequence ID | >WENV170957300 |
Genome ID | MKFH01001812 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 280 |
End posion on genome | 353 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aagaaccatg |
tRNA gene sequence |
GTGGCCATGGTGTAGAGGCAACACAGCGGGTTGTGGTCCCGTTATCATGGGTTCGATTCC |
Downstream region at tRNA end position |
tcgagaaata |
Secondary structure (Cloverleaf model) | >WENV170957300 His GTG g CCCA tcgagaaata G - C T - A G - C G - C C - G C - G A - T T T T T A C C C A G A G | | | | | G A T G T G A T G G G C G | | | | T T G A C A C C A A TATC G + T C - G G - C G - C G - C T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |