Sequence ID | >WENV170961962 |
Genome ID | MRWF01000524 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 198 |
End posion on genome | 114 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ggcaccctgt |
tRNA gene sequence |
GGAGGGGTGGGAGAGTGGTTAAATCCAGCAGACTGTAAATCTGCCCGCTATGCGTACGCT |
Downstream region at tRNA end position |
cccttcgccc |
Secondary structure (Cloverleaf model) | >WENV170961962 Tyr GTA t ACCA cccttcgccc G - C G - C A - T G - C G - C G - C G - C T A T C G A C C A T G A G | | | | | G G G A G G G C T G G C G | | | T T T A T C C T A A A CCGCTATGCGTAC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |