Sequence ID | >WENV170961984 |
Genome ID | MRWF01000714 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 1331 |
End posion on genome | 1243 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cgcgtccgcT |
tRNA gene sequence |
GGAGCTGTGGCTGAGCGGTTGAAGGCGCTCGACTTGAAATCGAGTGAACCCGCAAGGGTT |
Downstream region at tRNA end position |
atcccgcccc |
Secondary structure (Cloverleaf model) | >WENV170961984 Ser TGA T GTtg atcccgcccc G - C G - C A - T G - C C - G T + G G - C T A T C A C C C A C G A G | | | | | G G G T C G G T G G G C G + | | T T T A G G C T G A G TGAACCCGCAAGGGTTCC C - G T - A C - G G - C A - T C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |