Sequence ID | >WENV170962004 |
Genome ID | MRWF01001987 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 4711 |
End posion on genome | 4621 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tggaaaaacc |
tRNA gene sequence |
GGTGGGCTGGCAGAGTGGCTGAATGCAGCGGTCTTGAAAACCGCCGAAGGTTAGTAGCCT |
Downstream region at tRNA end position |
tttttcctct |
Secondary structure (Cloverleaf model) | >WENV170962004 Ser TGA c GCCA tttttcctct G - C G - C T - A G - C G - C G - C C - G T A T G T C C C A T G A G | + | | | G G G A C G C G G G G C G | | | T T C A T G C T G A A CGAAGGTTAGTAGCCTTCC G - C C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |