Sequence ID | >WENV170962012 |
Genome ID | MRWF01002060 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 205 |
End posion on genome | 294 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
catgacccgc |
tRNA gene sequence |
GGAGAGGTGGCAGAGTGGTCGAATGCACCGCACTCGAAATGCGGCATACTCGCAAGGGTA |
Downstream region at tRNA end position |
cttcggtatg |
Secondary structure (Cloverleaf model) | >WENV170962012 Ser CGA c GCCA cttcggtatg G - C G - C A - T G - C A - T G - C G - C T A T C C C C C A T G A G | | | | | G G G A C G G G G G G C G | | | T T T A T G C C G A A CATACTCGCAAGGGTATC C - G C - G G - C C - G A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |