Sequence ID | >WENV170962023 |
Genome ID | MRWF01002762 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 16092 |
End posion on genome | 16165 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gatcttttcc |
tRNA gene sequence |
GGCGCGGTGGCAGAGTGGTTATGCAGCGGACTGCAACTCCGTGTACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
attttaccct |
Secondary structure (Cloverleaf model) | >WENV170962023 Cys GCA c TCCA attttaccct G - C G - C C - G G - C C - G G - C G - C T T T C A G C C A G A G | | | | G T G A C G G C C G G C G | | | T T G A T G C T T A GTAC G + T C - G G - C G - C A - T C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |