Sequence ID | >WENV170962045 |
Genome ID | MRWF01003905 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 1338 |
End posion on genome | 1425 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gcgccccatc |
tRNA gene sequence |
GGAGAGGTGGCAGAGCGGTTGAATGCGCTGGATTCGAAATCCAGTATGGACTTCGGTTCA |
Downstream region at tRNA end position |
cgataagacc |
Secondary structure (Cloverleaf model) | >WENV170962045 Ser CGA c GCtt cgataagacc G - C G - C A - T G - C A - T G - C G - C T A T C C C C C A C G A G | | | | | G G G A C G G G G G G C G | | | T T T A T G C T G A G TATGGACTTCGGTTCATC C - G T - A G - C G - C A - T T A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |